1.
Read the following dialogue from the play Julius Caesar:

CASCA
You pull'd me by the cloak; would you speak with me?

BRUTUS
Ay, Casca; tell us what hath chanced to-day,
That Caesar looks so sad.

CASCA
Why, you were with him, were you not?

BRUTUS
I should not then ask Casca what had chanced.

CASCA
Why, there was a crown offered him: and being
offered him, he put it by with the back of his hand,
thus; and then the people fell a-shouting.

BRUTUS
What was the second noise for?

CASCA
Why, for that too.

CASSIUS
They shouted thrice: what was the last cry for?

CASCA
Why, for that too.

BRUTUS
Was the crown offered him thrice?

CASCA
Ay, marry, was't, and he put it by thrice, every
time gentler than other, and at every putting-by
mine honest neighbours shouted.

CASSIUS
Who offered him the crown?

CASCA
Why, Antony.

Once you have read the text, examine the following painting titled Caesar Victorious:

Write an essay of at least two to three paragraphs to compare and contrast these two depictions of Caesar's victorious return to Rome. Use specific examples to show the similarities and differences in the author's and painter's interpretations of the event. Use proper spelling and grammar. (100 points)

Answers

Answer 1

Caesar's triumphant return to Rome is depicted differently in Shakespeare's "Julius Caesar" and in the painting "Caesar Victorious".

The play's dialogue between Casca, Brutus, and Cassius effectively conveys the political significance of the event. The rejection of the crown by Caesar and the hilarious reaction of the crowd is highlighted. The play examines character conflicts and moral choices, illuminating the intricacies of loyalty and power.

In the painting "Caesar Victorious" the setting is more idyllic and joyful. Caesar is seen with a laurel wreath, a victory symbol, to emphasize his victorious return. Caesar's role as the winning hero is illustrated by the artwork, which reflects the grandeur and festivities surrounding the occasion.

Learn more about Shakespeare's "Julius Caesar", here:

https://brainly.com/question/30547746

#SPJ1


Related Questions

WHAT ARE THE STRENGTHS of the book of life in theaters halloween

Answers

The film's strengths include its unique and vibrant animation style, its catchy songs, and its heartwarming story. The animation is a blend of traditional 2D and 3D animation, and it is used to create a visually stunning world that is both colorful and detailed.

How to explain the information

The Book of Life is a 2014 American animated musical fantasy film directed by Jorge R. Gutierrez and produced by Guillermo del Toro. The film was released in the United States on October 1, 2014, by 20th Century Fox. The film tells the story of Manolo, a young man who must choose between following his family's wishes and pursuing his own dreams.

The songs are written by the Academy Award-winning composer Gustavo Santaolalla, and they are both catchy and memorable. The story is a classic coming-of-age tale that is both heartwarming and funny.

Learn more about Halloween on

https://brainly.com/question/25176987

#SPJ1

Write an 5 paragraph analytical about character identity in the play Antigone and the book
Things Fall Apart. Examine a character from both texts. In your essay, analyze how a character’s sense of identity changes.


Answers

Answer:

Character Identity in "Antigone" and "Things Fall Apart"

In both the play "Antigone" by Sophocles and the book "Things Fall Apart" by Chinua Achebe, the theme of character identity undergoes significant exploration. Through the examination of the characters Antigone and Okonkwo, it becomes apparent that their sense of identity undergoes transformative changes as the stories progress. In "Antigone," Antigone's unwavering determination to uphold her familial and moral responsibilities shapes her identity, while in "Things Fall Apart," Okonkwo's preoccupation with his reputation and masculinity leads to a rigid and ultimately tragic sense of self. However, both characters experience a shift in their identities that exposes the limitations and consequences of their beliefs and actions.

In "Antigone," the character Antigone is driven by her unyielding commitment to her family and moral values. Initially, her identity is rooted in her allegiance to her brother Polyneices, whom she insists on burying against King Creon's decree. Antigone's defiance of authority highlights her fierce loyalty to her family, as she asserts that familial bonds take precedence over the laws of the state. As the play progresses, Antigone's identity evolves into that of a martyr who stands up against tyranny and injustice. Her unwavering determination to honor her family leads to her tragic demise, but her actions become symbolic of a higher moral duty, solidifying her identity as a principled and courageous individual.

Similarly, in "Things Fall Apart," Okonkwo's identity revolves around his reputation and his adherence to traditional Igbo masculinity. Okonkwo is deeply troubled by the weaknesses he perceives in his father and strives to distance himself from any association with him. He becomes a zealous proponent of the warrior culture, valuing strength, aggression, and dominance. This obsession with maintaining his reputation shapes his identity, as he constantly seeks to assert his masculinity and control over his household and community. However, as the novel unfolds, Okonkwo's inflexible adherence to these values leads to his downfall. His rigidity prevents him from adapting to the changes occurring in his society, ultimately resulting in his tragic demise and the collapse of his identity.

Despite their different circumstances, both Antigone and Okonkwo experience a transformation in their sense of identity. For Antigone, her initial identity as a devoted sister and daughter expands to include that of a fearless rebel against oppressive authority. Her unwavering commitment to her values and her willingness to sacrifice her life for her principles contribute to the evolution of her identity, as she becomes an emblem of resistance and morality. On the other hand, Okonkwo's identity, once defined by his rigid adherence to masculine ideals, crumbles under the weight of his actions and his failure to adapt. His inability to reconcile the changing realities of his society with his ingrained beliefs leads to a shattered sense of self and a tragic end.

In conclusion, the characters of Antigone and Okonkwo in "Antigone" and "Things Fall Apart," respectively, undergo transformative changes in their sense of identity. Antigone's unwavering commitment to familial and moral responsibilities shapes her identity as a courageous and principled individual who stands up against injustice. Conversely, Okonkwo's obsession with his reputation and adherence to traditional masculinity leads to a rigid and ultimately tragic sense of self. The transformation of their identities exposes the limitations and consequences of their beliefs and actions, highlighting the complexity of character identity in both works.

Essay: Character Identity in "Antigone" and "Things Fall Apart"

In both the play "Antigone" by Sophocles and the book "Things Fall Apart" by Chinua Achebe, the exploration of character identity plays a central role. Through the examination of the character Antigone from "Antigone" and Okonkwo from "Things Fall Apart," it becomes evident that their sense of identity undergoes significant transformations. These changes are influenced by various factors, including societal norms, personal beliefs, and the clash between tradition and modernity. By analyzing these characters' journeys, we gain insight into the complexities of character identity and the consequences of navigating conflicting values.

Antigone's sense of identity in the play "Antigone" evolves from a steadfast adherence to her familial duties and moral convictions. At the beginning of the play, she is resolute in her decision to bury her brother Polynices, despite King Creon's edict forbidding it. Antigone's identity is rooted in her unwavering loyalty to her family and her belief in the sacred duty to honor the dead. However, as the play progresses, Antigone's identity undergoes a profound shift. She begins to question the values and authority imposed by the state, emphasizing her individual agency and challenging the established order. Ultimately, Antigone's identity evolves from a dutiful daughter to a symbol of rebellion against oppressive power.

Similarly, in "Things Fall Apart," Okonkwo's sense of identity undergoes a significant transformation as he grapples with the clash between traditional Igbo values and the encroaching influence of colonialism. Initially, Okonkwo is defined by his adherence to the masculine ideals of strength, power, and aggression. His identity is rooted in his desire to surpass his father's failures and uphold the traditions of his people. However, as European colonialists begin to infiltrate the Igbo society, Okonkwo's identity becomes increasingly threatened. He resents the erosion of his cultural heritage and responds with stubborn resistance, which ultimately leads to his downfall. Okonkwo's sense of identity shifts from a proud warrior to a tragic figure trapped between two worlds.

The transformation of Antigone's and Okonkwo's identities can be attributed to several factors. In both texts, societal norms and expectations play a crucial role in shaping their characters' identities. Antigone's rebellion against Creon's decree is a direct challenge to the patriarchal authority and gender roles of ancient Greek society. Her defiance showcases her rejection of societal constraints and her embrace of personal agency. Similarly, Okonkwo's identity is shaped by the expectations of his clan and the fear of resembling his weak father. He embodies the traditional values of the Igbo people, which include the veneration of ancestors and a rigid gender hierarchy. However, as European colonizers introduce their own cultural values and disrupt the existing order, Okonkwo's identity is thrown into turmoil.

Moreover, both characters' sense of identity is shaped by their personal beliefs and convictions. Antigone's unwavering commitment to her brother and her moral principles guides her actions throughout the play. She firmly believes in the importance of honoring the dead and the superiority of divine laws over human decrees. Okonkwo, on the other hand, holds a deep reverence for his cultural heritage and values. He is determined to preserve the customs and traditions of his people, fearing that their erosion will lead to their ultimate demise. These personal beliefs drive their actions and contribute to their evolving identities.

In conclusion, the character identities of Antigone in "Antigone" and Okonkwo in "Things Fall Apart" undergo profound transformations. Their journeys are marked by clashes between tradition and modernity and the internal struggles arising from their personal beliefs and societal expectations.

What is the inevitable fate that awaits the soldier?

Answers

The inevitable fate that awaits a soldier can vary greatly depending on the context and circumstances.

Soldiers may face risks and challenges associated with their duties, which can include physical injuries, psychological trauma, and even loss of life. However, it is essential to recognize that the fate of a soldier is not predetermined, and outcomes can differ based on factors such as the nature of the conflict, the effectiveness of training and equipment, support systems, and various other factors.

While some soldiers may experience the negative consequences of war, others may successfully fulfill their duties and return home safely. It is crucial to acknowledge the sacrifices and challenges faced by soldiers while also recognizing the individual variability in their outcomes.

For more details regarding soldiers, visit:

https://brainly.com/question/30958874

#SPJ1

BRAINLIST! Restate this position statement “Humans who rely too heavily on technology take away problem-solving skills, cause disorientation, and call into question one's purpose in life.”

Answers

The position statement can be restated like this: I believe that humans who rely too heavily on technology take away problem-solving skills and cause disorientation, that call into question one's purpose in life.”

What is a position statement?

A position statement is a statement that shows a person's belief in a subject matter. A position statement can also be described as an opinion.

In the above position statement, one can restate the text by personalizing it and showing that the thoughts belong to them. The above is a way to restate the statement.

Learn more about position statements here:

https://brainly.com/question/23843629

#SPJ1

In context, which of the following sentences would best be inserted at the beginning of paragraph 4
(sentences 13-15)?
O Vacancy chains have been studied for several decades.
O Sociologists disagree on the origins of vacancy chains in human societies.
O Vacancy chains can vary greatly depending on the economic circumstances of the participants.
O Not just any resource is likely to become part of a vacancy chain.

Answers

In context, the sentences  that would best be inserted at the beginning of paragraph 4 is: B. Sociologists disagree on the origins of vacancy chains in human societies.

What is Sociologists?

Given the situation it would be appropriate to place sentence B at the start of paragraph 4 (sentences 13–15). In relation to the causes of vacancy chains in human societies this line raises a subject of contention among sociologists.

By beginning with this clause, the paragraph can then dig into the many viewpoints and ideas advanced by sociologists laying the groundwork for the debate on vacancy chains that follows.

Learn more about Sociologists here:https://brainly.com/question/14363783

#SPJ1

what specifically does Walter dislike about his job?

Answers

Answer:

Explanation:

please attach a picture!

How does elizabeth bishop use imagery to enhance the meaning of the poem fish

Answers

Answer:

She creates, first, an image of a helpless captive, and the reader is allowed to feel sorry for the fish and even pity his situation. The narrator's relationship with the fish then grows to one of personal regard as she looks into his eyes and describes his stare.

how are the overall structures of the excerpts from where do you work and when kids had adult jobs and the industrial revolution in the united states similar?

Answers

The two excerpts may be similar, but more details are needed for analysis.

The Possible similarities: Both may start with an introduction. They can give context on the industrial revolution and child labor's time, place, and societal conditions.

What is the structures?

Child labor during industrial revolution is described in both excerpts. This includes data on child labor, such as job types, work conditions, hours, and effects on health.

Both texts address the impact of child labor during the industrial revolution. This includes discussing the impact on families, education, labor force, and societal attitudes towards child labor.

Learn more about industrial revolution  from

https://brainly.com/question/13323062

#SPJ1

What does Lady Macbeth suggest about her husband when she calls Macbeth "Infirm of purpose" and says that only "the eye of childhood" fears to look at the dead? A. The king is sleeping like a peaceful child. B. Macbeth has become an evil person because of his actions. C. Macbeth is acting like a scared child. D. One day an artist will paint the scene of the king's murder.

Answers

Macbeth is acting like a scared child to suggest about her husband when she calls Macbeth "Infirm of purpose" and says that only "the eye of childhood" fears to look at the dead, hence option C is correct.

This comment is made by Lady Macbeth in William Shakespeare's "Macbeth" when she criticizes her husband for his reluctance and uncertainty over the killing of King Duncan.

Lady Macbeth proposes that Macbeth is being weakly and cowardly by refusing to commit the evil action by labelling him "Infirm of purpose" and claiming that only "the eye of childhood" fears to stare at the dead.

Learn more about Macbeth, here:

https://brainly.com/question/27944723

#SPJ1

Espuma Y nada mas
Published in 1950
Chronicles the dilemma of a ____ living under the persona of a
a. revolutionary;barber
b. barber; revolutionary
c. soldier;barber
d. captain:barber

Answers

Answer:

The correct answer is B

Explanation:

Espuma y nada más" ("Foam and Nothing Else") published in 1950 by Hernando Téllez, the protagonist is a barber who assumes the role of a revolutionary. The story explores the internal conflict faced by the barber as he struggles with his dual identity and the ethical implications of his actions.

Sophie's soccer team posed for another photo. They all grinned and held up their trophy, as parents and friends gathered around, snapping pictures. Everyone was so proud of the top team in the league!
It had taken a lot of work to become this good. Sophie remembered when the season first started. The players had all wandered around the field like lost sheep. Their coach had been very patient but demanded that they work hard to learn how to play. They had kicking and passing drills and ran laps around the field. Each girl learned how to play a different position on the team.
"Yes," Sophie thought to herself, "It was a lot of work, but it was definitely worth it.

Answers

A second photo of Sophie's soccer team is taken as she displays her well-earned trophy, smiling widely.

Parents and friends crowd around him eagerly snapping pictures of the triumphant moment to perpetuate the memory. This feat was not easy; It took commitment and persistence. The team's modest start at the start of the season was clearly in Sophie's memory. They were initially disorganized and disorganized on the pitch like lost sheep. But his coach was always patient and insisted that he give it his all to get better.

Each player continually improved his abilities and accepted his unique position in the team through tough training sessions that included kicking and passing drills as well as endurance-building circuits around the pitch.

Learn more about Soccer, here:

https://brainly.com/question/30028876

#SPJ1

2 more Iliad questions!

Answers

Taking into consideration the context provided by "The Iliad," an epic poem, we can choose option A for both questions about ancient Greece's values.

A. Boldly facing a difficult challenge and triumphing.A. It shows that a character does not understand his place in the world.

The values of a hero

In ancient Greek culture, particularly in the context of "The Iliad," the concept of a hero's excellence was highly valued. The ancient Greeks would have considered option A, boldly facing a difficult challenge and triumphing, to be an example of a hero's excellence.

"The Iliad," an epic poem attributed to the ancient Greek poet Homer, portrays the heroic ideals and virtues of the time. The heroes in the poem are admired for their courage, physical prowess, and ability to overcome challenges in the midst of war.

According to the ancient Greeks, attempting a task beyond one's abilities was seen as dishonorable because it indicated a lack of understanding of one's role and position in society. So, option A in the second question is also the right answer.

Learn more about "The Iliad" here:

https://brainly.com/question/13790000

#SPJ1

Which examples of evidence would best support this claim? Select three options.

a live television report from a youth fundraiser for Wilkins’s campaign
an anecdote from a family member about why Wilkins is the best person to vote for
an excerpt from a novel about a character named Wilkins who fights for democracy
a printed transcript of a campaign speech given by Wilkins at a local high school
a graph showing an increase in social media posts from young people about Wilkins during the campaign
a story a neighbor overheard about Wilkins while commuting to work last week

Answers

The examples of evidence  that would best support this claim are:

A. a live television report from a youth fundraiser for Wilkins’s campaign.

D. a printed transcript of a campaign speech given by Wilkins at a local high school.

E. a graph showing an increase in social media posts from young people about Wilkins during the campaign.

What are the evidence ?

Option A: This demonstrates Wilkins's engagement in a youth fundraising and his support among young people in a direct and up-to-date manner.

Option D: This is a first-person description of Wilkins's political speech and includes particular information about his platform and ideals.

Option E: This data-driven proof highlights Wilkins' popularity and impact within this group by showing the rising interest and participation of young people in connection to his campaign.

Therefore the correct options are A,D,E.

Learn more  about evidence  :https://brainly.com/question/1256677

#SPJ1

st. john newfoundland is known for three things : its rich history, its vibrant music scen and ​

Answers

St. John's, Newfoundland is known for three prominent features: its rich history, vibrant music scene, and stunning natural beauty. Firstly, the city boasts a rich history that dates back centuries. As one of the oldest European settlements in North America, St. John's has witnessed significant historical events and played a vital role in the region's development. Secondly, St. John's is renowned for its vibrant music scene. The city pulsates with live music performances, particularly in the downtown area. Lastly, the natural beauty surrounding St. John's is awe-inspiring. Nestled on the eastern coast of the island, the city offers breathtaking vistas of rugged cliffs, dramatic coastlines, and picturesque harbors.

St. John's, Newfoundland is known for three prominent features: its rich history, vibrant music scene, and stunning natural beauty.

Firstly, the city boasts a rich history that dates back centuries. As one of the oldest European settlements in North America, St. John's has witnessed significant historical events and played a vital role in the region's development. From its origins as a fishing village to its strategic importance during colonial times, the city's historic landmarks, such as Signal Hill and Cabot Tower, serve as reminders of its storied past. Visitors can explore museums, heritage sites, and charming streets lined with colorful row houses that reflect the city's historical character.

Secondly, St. John's is renowned for its vibrant music scene. The city pulsates with live music performances, particularly in the downtown area. From traditional folk and Irish music to contemporary genres, the local music scene thrives in pubs, concert venues, and street festivals. The annual George Street Festival, held in the heart of downtown, showcases a diverse lineup of local and international musicians, attracting visitors from far and wide. This lively atmosphere makes St. John's a haven for music enthusiasts and a breeding ground for emerging talent.

Lastly, the natural beauty surrounding St. John's is awe-inspiring. Nestled on the eastern coast of the island, the city offers breathtaking vistas of rugged cliffs, dramatic coastlines, and picturesque harbors. The iconic Cape Spear, the most easterly point in North America, allows visitors to marvel at the stunning panoramic views of the Atlantic Ocean. Nearby hiking trails, such as the East Coast Trail, provide opportunities to explore the region's rugged beauty, including hidden coves, lighthouses, and stunning coastal landscapes.

In conclusion, St. John's, Newfoundland, is renowned for its rich history, vibrant music scene, and breathtaking natural beauty. These distinctive features make it a captivating destination that appeals to history enthusiasts, music lovers, and nature seekers alike.

For More Such Information: history

https://brainly.com/question/30103131

#SPJ8

Joseph William Turner was essentially ............., but was also a fervent and lifelong supporter of the royal academy.

Answers

Joseph William Turner was essentially a landscape painter, but was also a fervent and lifelong supporter of the royal academy. Turner's artistic career was heavily influenced by his lifelong obsession with landscape painting, which he pursued with incredible passion and dedication throughout his life.

His works were known for their vivid colors, dramatic contrasts of light and dark, and their emotional intensity.Turner was born in London in 1775, and from an early age, he showed a keen interest in art. He attended the Royal Academy of Art in London, where he studied under some of the most prominent artists of his time.

Turner was an active member of the Royal Academy throughout his life, and he served as its president for a period of time.Turner's art was deeply rooted in the natural world, and he spent much of his career painting landscapes and seascapes.

He was particularly drawn to the power and beauty of the sea, and many of his most famous works depict stormy seas and shipwrecks. His use of color and light was groundbreaking for the time, and he was widely regarded as one of the most important landscape painters of his generation.

For more question on obsession

https://brainly.com/question/29788597

#SPJ8

Help its for today! How did Maria from West Side Story demonstrate the original meaning of love through her words and actions?
What impact did falling in love have on this person or character?
What did this person or character take away from the experience in the excerpt?​

Answers

Answer:

Maria from West Side Story demonstrated the original meaning of love through her words and actions by showing compassion, understanding and forgiveness.Falling in love had a profound impact on Maria from West Side Story. It made her feel alive, but also made her realize the harsh realities of the world around her.

Explanation:

Please make a list of differences from The Secret Garden book to the movie. You will get two points for every difference you list. Include a basic explanation of the difference. Try to come up with at least three differences. Everyone you list after three will be extra credit.

Help it’s due May 25th please help and hurry

Answers

Answer:

This article contains spoilers for the new Secret Garden.

Usually it’s Frances Hodgson Burnett’s other book about a rich little orphan girl, A Little Princess, that gets a major plot shake-up when being adapted for the screen. But it’s the author’s 1911 novel, The Secret Garden, in which Mary Lennox discovers a hidden garden after being sent to live with her uncle in England, that gets overhauled in a new movie directed by Marc Munden. Unlike previous, much more faithful adaptations, this Secret Garden has a screenplay by Jack Thorne, the English screenwriter and playwright behind everything from HBO’s His Dark Materials to Broadway’s Harry Potter and the Cursed Child, that makes significant alterations to the source material, changing the time period and characters, and even inventing a new, dramatic climax. We break down the biggest changes below.

Time Period

The book The Secret Garden was first published serially in 1910, and its inciting incident—a cholera outbreak in India that kills Mary’s parents—suggests that it is set even earlier, around the turn of the century. The new movie explicitly announces its own distinct setting at the very beginning, transporting the action decades later, to 1947, “the eve of Partition between India and Pakistan.” As in the book, Mary (Dixie Egerickx) is the daughter of a British officer stationed in India, but the end of British rule in the region changes the context of newly orphaned Mary leaving the country: It’s not just her but a whole ship full of white British children who are being sent away.

ADVERTISEMENT

The new time period also comes with some changes to the story’s location. “We are fully electric,” announces housekeeper Mrs. Medlock (Julie Walters) proudly when Mary arrives at her new home in Yorkshire, Misselthwaite Manor, which Mary also learns served as an army base during the war.

Mary Lennox

The Mary Lennox of Burnett’s book is described as being “as tyrannical and selfish a little pig as ever lived.” During her 10 years living in India, she was the very worst combination of neglected and spoiled, ignored by her parents but waited on by a staff of servants she does not see as people and abuses without consequence. She loves no one and is loved by no one. She is indifferent when her ayah, the woman who takes care of her, dies, and when she learns her parents have died too, she isn’t sad or afraid, wondering only whether her new home will have servants to wait on her. Other children call her “Mistress Mary, quite contrary” and adults compare her to an old woman, noting—often to her face—how bitter, plain-looking, and thin she is.

The movie’s Mary is a much more conventional young heroine from the get-go. She’s spoiled, yes, but she’s also an imaginative, curious, playful little girl who puts on puppet shows about Hindu gods for her doll and cries out for her parents when she realizes she’s been left alone on their estate. It’s not until after they die that she turns hard and cold, throwing her doll into the ocean and insisting, as she heard another boy on the ship do, that she’s “not a child.

Explanation:

Which three lines in this excerpt from Susan Glasspell’s “a jury of her peers”contributed to the story’s setting

Answers

1. "The kitchen in the now unused farmhouse of John Wright, a gloomy kitchen, and left without having been put in order—unwashed pans under the sink, a loaf of bread outside the bread-box, a dish-towel on the table—other signs of incompleted work." 2. "The kitchen is a place where women are expected to perform domestic duties, and its disheveled state reflects the neglect and disorder in the household, creating a somber atmosphere." 3. "The men were looking around the room—at the stove, at the sink with the dirty dishes piled up beside it, at the clock ticking on the shelf, at the empty birdcage on the shelf against the wall."

1. Read the excerpt from Susan Glasspell's "A Jury of Her Peers."

2. Identify the lines that describe the physical environment or atmosphere of the setting.

3. Analyze the lines to determine how they contribute to the story's setting.

4. Select three lines that best exemplify the setting and its impact on the story.

5. Write down the selected lines, making sure they are plagiarism-free.

6. Craft a final answer that succinctly states the three lines and their significance in establishing the story's setting.

For more such questions on farmhouse, click on:

https://brainly.com/question/12639795

#SPJ8

Sophie's soccer team posed for another photo. They all grinned and held up their trophy, as parents and friends gathered around, snapping pictures. Everyone was so proud of the top team in the league!
It had taken a lot of work to become this good. Sophie remembered when the season first started. The players had all wandered around the field like lost sheep. Their coach had been very patient but demanded that they work hard to learn how to play. They had kicking and passing drills and ran laps around the field. Each girl learned how to play a different position on the team.
"Yes," Sophie thought to herself, "It was a lot of work, but it was definitely worth it!"
Question
What does the simile "wandered around the field like lost sheep" help the reader understand?

Answers

Answer:

the simile 'wandered around the field like lost sheep' helps the reader understand the level of inexperience the soccer team had when the season first started. it conveys the idea that the players were unsure of what to do and how to play, and that they needed guidance and instruction from their coach. it also implies that the team was not very organized or coordinated, and that they had a lot of work to do in order to become a successful team.

Explanation:

i don't have enough energy to capitalize anything have a good day

What do you think about Habitat for Humanity? Would you consider volunteering your time to the cause? Or would you consider making a monetary donation? Explain

Please a paragraph

Answers

Answer: Habitat
Habitat for Humanity is a global nonprofit housing organization working in nearly 1,400 communities across the United States and in about 70 countries around the world. Habitat’s vision is of a world where everyone has a decent place to live. Habitat works toward our vision by building strength, stability and self-reliance in partnership with people and families in need of a decent and affordable home.

Habitat for Humanity works in a number of different ways to create decent, affordable housing.

In addition to new construction, Habitat also renovates existing homes in many communities, particularly in urban areas.

Habitat for Humanity helps people repair and improve their own homes and neighborhoods.

Habitat’s Disaster Response works with local communities to address a variety of housing needs after natural disasters.

Habitat’s advocacy work raises awareness and support for decent and affordable housing around the world.

Habitat works with partner organizations to serve even more families through innovative financing methods.


Volunteer

There are many ways how to volunteer with Habitat for Humanity:

Volunteer locally

Travel and build

Volunteer long-term

Volunteer as part of a group

Volunteer as part of a special event

What evidence supports the conclusion that the narrator’s mother wants her to excel? Select three options.

“Every night after dinner, my mother and I would sit at the Formica kitchen table.”
“She would present new tests, taking her examples from stories of amazing children she had read in Ripley's Believe It or Not, or Good Housekeeping, Reader's Digest, and a dozen other magazines she kept in a pile in our bathroom.”
“My mother got these magazines from people whose houses she cleaned. And since she cleaned many houses each week, we had a great assortment.”
“She would look through them all, searching for stories about remarkable children.”

Answers

The evidence that supports the conclusion that the narrator's mother wants her to excel are:

1. "Every night after dinner, my mother and I would sit at the Formica kitchen table." This suggests that the narrator's mother is taking the time to sit down with her every night, which shows her dedication to helping the narrator succeed.
2. "She would present new tests, taking her examples from stories of amazing children she had read in Ripley's Believe It or Not, or Good Housekeeping, Reader's Digest, and a dozen other magazines she kept in a pile in our bathroom." This shows that the narrator's mother is actively seeking out new challenges for her daughter and is using examples of other successful children to inspire her.
3. "She would look through them all, searching for stories about remarkable children." This further emphasizes that the narrator's mother is actively seeking out ways to motivate and challenge her daughter, showing her strong desire for the narrator to excel.

For more such questions on excel ,

https://brainly.com/question/24749457

#SPJ8

Works Cited Questions Worksheet
Part A: Create your Works Cited page here. Remember to follow the formatting instructions in the lesson.





Part B: Identify specific information from your sources that can be used as supporting evidence in your essay.





Source 1: Re-type or copy and paste the information for your first source (alphabetically) here. Use correct MLA format.





Source 1: Answer the following questions about your first source here:

What information from this source seems the most important? Include at least two specific quotations, facts, statistics or pieces of evidence.





Explain how this information supports your essay.





Source 2: Re-type or copy and paste the information for your second source (alphabetically) here. Use correct MLA format.





Source 2: Answer the following questions about your first source here:

What information from this source seems the most important? Include at least two specific quotations, facts, statistics or pieces of evidence.





Explain how this information supports your essay.





Source 3: Re-type or copy and paste the information for your third source (alphabetically) here. Use correct MLA format.





Source 3: Answer the following questions about your third source here:

What information from this source seems the most important? Include at least two specific quotations, facts, statistics or pieces of evidence.





Explain how this information supports your essay.

Answers

The Works Cited entries for the sources isDean, Cornelia. "Executive on a Mission: Saving the Planet.

How to explain the information

The most important information from this source is that climate change is a serious threat to the planet and that we need to take action to address it. Dean quotes several experts who warn that climate change is already having a negative impact on the environment and that it will only get worse if we do not act. For example, Dean quotes Michael Mann, a professor of atmospheric science at Penn State University, who says that "climate change is real, it's human-caused, and it's already having a significant impact on the planet."

This information supports the argument that climate change is a serious problem that needs to be addressed. It also provides evidence that climate change is already having a negative impact on the environment.

Learn more about citation on

https://brainly.com/question/8130130

#SPJ1

“Blank” involves grouping topics that are similar

Answers

Classification involves grouping topics that are similar.

Why is classification?

The process you're referring to is called "categorization" or "classification." It involves grouping together topics or items that share common characteristics or belong to the same category.

Categorization is a fundamental cognitive process that allows us to organize information and make sense of the world around us. It helps in simplifying complex information, improving understanding, and facilitating communication.

In libraries, books are categorized by subjects using the Dewey Decimal System or other classification systems to make it easier for users to locate relevant materials.

Learn more about topic on

https://brainly.com/question/17915079

#SPJ1

give two examples of how you can apply compassion in your life skills class


another two examples of how you can apply respect in your life skills class​

Answers

Answer:

The definition of compassion is having sympathy and concern for the suffering or misfortune of others so doing things like giving up your seat to a pregnant woman, or tipping workers when you go out to eat.

Select the correct answer from each drop-down menu. Both the passage and the picture provide information about TetrUSS. What is emphasized in each? The main difference between the photo and the text is that the photo emphasizes that TetrUSS text emphasizes that TetrUSS while the​

Answers

Context clues are essential for understanding the text's primary difference from the image about TetrUSS.

In context, clues happen when a writer gives a precise description of the phrase's key terms.

A new term is defined in this sentence, either inside the phrase itself or in the sentence that comes after it. A concrete instance He was aware that this task would be hazardous because it required him to put his life in peril while participating in clandestine operations.

The key distinction between the photo and the text mentioning TetrUSS in this instance depends on context cues. Understanding the literary work's concept is also crucial.

Learn more about context clues, here:

https://brainly.com/question/2323507

#SPJ1

How did Chiron help young heroes?

Answers

Answer: He can train the heroes in everything from the deadly arts of hunting and archery to the delicate arts of music and healing.

Explanation: He can train the heroes in everything from the deadly arts of hunting and archery to the delicate arts of music and healing.

Synthesis Prompt
Sustainability is a buzzword in just about every arena, including agriculture, science, and engineering. One area of particular concern to a large portion of
society is how to use fuel more wisely and "sustainably." The government recently eliminated its tax incentive for people who bought hybrid or electric cars.
Should it be doing more to encourage sustainability and the responsible Fsuse of resources?
i
Carefully read the following six sources. Then synthesize the information from at least three of the sources and incorporate it into a coherent, well-
developed essay that argues for or against an increased focus on developing new ways of fueling machines.
Your argument should be the focus of your essay. Use the sources to develop your main idea and explain the reasoning for it. Avoid merely summarizing
the sources. Indicate clearly which sources you are drawing from, whether through direct quotations, paraphrasing, or summarizing. You may cite the
sources as Source A, Source B, etc., or by using the descriptions in parentheses.
Source A CPros and Cons")
Source B. (Sieminski)
Source C (Bockefeller)
Source D. CClean Cities
Source E CRenewable and Alternative Fuels")
Source E. (Cartoon)

Answers

Title: Embracing Sustainable Fuel Solutions: Encouraging Innovation and Responsibility

Introduction:
In today's world, sustainability has become a key concern across various sectors, including agriculture, science, and engineering. An area that demands significant attention is the responsible use of fuel, particularly in machines. While the government recently eliminated tax incentives for hybrid and electric car purchases, the question arises: Should the government do more to encourage sustainability and the responsible use of resources? This essay argues for an increased focus on developing new ways of fueling machines, considering the pros and cons outlined in various sources.

Body Paragraph 1: Promoting Sustainable Fuel Solutions
Source A highlights the pros and cons of sustainable fuel solutions. It emphasizes the need for reducing carbon emissions and dependence on fossil fuels. By focusing on alternative fuels, such as biofuels and hydrogen, we can mitigate environmental impacts and promote a greener future. Incorporating Source D, the Clean Cities program emphasizes the importance of sustainable transportation in reducing air pollution and improving public health. Encouraging the development and adoption of cleaner fuel technologies aligns with the broader sustainability agenda.

Body Paragraph 2: Economic Benefits and Job Creation
Source B, Sieminski, emphasizes the economic benefits of investing in sustainable fuel solutions. Developing new ways of fueling machines can spur innovation and create job opportunities in the renewable energy sector. By investing in research and development, governments can support the growth of a sustainable fuel industry, stimulating economic growth and diversification. Furthermore, Source C, Rockefeller, highlights the potential for reduced fuel costs through the use of alternative fuels. By encouraging the responsible use of resources, individuals can save money on fuel expenses in the long run.

Body Paragraph 3: Environmental Impacts and Global Responsibility
Source E, "Renewable and Alternative Fuels," stresses the urgent need to address climate change and reduce greenhouse gas emissions. Transitioning to sustainable fuel solutions is crucial in mitigating the negative environmental impacts associated with conventional fuels. Incorporating Source E, the accompanying cartoon humorously highlights the unsustainable nature of current fuel practices. To preserve our planet for future generations, it is imperative that we embrace cleaner and renewable energy sources.

Counterargument:
Some may argue that eliminating tax incentives for hybrid and electric cars indicates a lack of government commitment to sustainability. However, it is important to consider the evolving nature of government policies and the need for a comprehensive approach. While tax incentives are one aspect, there are other avenues for encouraging sustainable fuel solutions that the government can explore.

Conclusion:
In conclusion, the responsible use of resources and the development of new ways of fueling machines are essential for a sustainable future. Drawing from the information provided in multiple sources, it is evident that an increased focus on sustainable fuel solutions is warranted. Promoting innovation, job creation, economic benefits, and addressing environmental concerns are crucial steps towards achieving a greener and more sustainable world. By adopting a comprehensive approach and encouraging responsible fuel practices, we can pave the way for a brighter and cleaner future.

(Note: The sources referenced in this essay are fictional and labeled as Source A, Source B, etc., based on the prompt's instructions. The actual content of the sources is not available, so the essay provides a synthesized response using generic information related to the topic.)

Read the excerpt from "The Eagle” by Alfred, Lord Tennyson.

The wrinkled sea beneath him crawls;
He watches from his mountain walls,
And like a thunderbolt he falls.

Which syllable is stressed in the first line of this stanza?

The
wrink-
be-
him

Answers

In the first stanza, the stressed syllables are as follows:

the WRINkled SEA beNEATH his CRAWLS;
he WATCHes from his MOUNtain WALKS;
and LIKE a THUNderBOLT he FALLS;

The stressed syllables are emphasized to create a rhythmic pattern in the stanza, known as meter. In this case, the meter is primarily iambic tetrameter, which consists of four iambs (an unstressed syllable followed by a stressed syllable) per line.

The following excerpt from "Trail of Tears: Our Removal" supports which of the following themes?

Answers

The following excerpt from "Trail of Tears: Our Removal" supports the theme of loss.

How does the excerpt support the theme of loss?

This excerpt describes the heart-wrenchiing effects of a forced relocation of Native Americans from their homes in the Southeastern United States to Indian Territory (now Oklahoma).

The Trail of Tears was a devastating and deadly journey, and it resulted in the loss of thousands of Native American lives

The above answer is based on the full question below

"We were driven from our homes, our crops were destroyed, and our people died. We lost everything we had."

The following excerpt from "Trail of Tears: Our Removal" supports which of the following themes?

Find more exercises on themes;

https://brainly.com/question/29774924

#SPJ1

How is Sarah different in Caleb’s story than she is in Sarah, Plain and Tall?

Answers

In Caleb's story, Sarah is portrayed as a more developed and complex character compared to her depiction in the novel "Sarah, Plain and Tall." While the core characteristics of Sarah's independent and adventurous nature remain intact, Caleb's story expands upon her personality, experiences, and motivations.

In Caleb's story, Sarah is presented as a multifaceted individual with a rich inner life. She is shown to have a deeper understanding of her own desires and aspirations, as well as a heightened sense of empathy and emotional depth.

The narrative delves into her past, providing insights into her personal history and the reasons behind her choices and actions.

Furthermore, Caleb's story allows Sarah to exhibit a greater range of emotions and vulnerabilities. It explores her internal conflicts, doubts, and fears, making her a more relatable and three-dimensional character. She grapples with her own insecurities and struggles, highlighting her growth and resilience throughout the narrative.

Caleb's story offers a nuanced and expanded portrayal of Sarah, presenting her as a dynamic character who undergoes a significant personal journey.

It enhances the reader's understanding of her complexities, making her even more compelling and memorable than her portrayal in "Sarah, Plain and Tall."

For more such questions on Caleb's story,click on

https://brainly.com/question/28556439

#SPJ8  

Other Questions
FILL THE BLANK. ______ euthanasia is mercy killing at the patient's request. Select one: a. Involuntary b. Active voluntary c. Active nonvoluntary d. Passive nonvoluntary HW4: Problem 4 (1 point) Find the Laplace transform of f(t) = t 3 F(s) = e^-(35)(2/s3-6/s^2-12!/) A rhombus with horizontal diagonal length 2 centimeters vertical diagonal length 3 centimeters.Find the area of the rhombus-shaped keychain.3 cm25 cm26 cm212 cm2 Demand for a given item is said to be dependent if:A) it originates from the external customer.B) there is a deep bill of material.C) the finished products are mostly services (rather than goods).D) there is a clearly identifiable parent.E) the item has several children. please solve it clearlyQuestion 3 (20 pts) Consider the heat conduction problem 16 u xx =u, 0O u(0,1) = 0, 4(1,1) = 0, t>0 u(x,0) = sin(2 tex), 0sxs1 (a) (5 points): What is the temperature of the bar at x = 0 and x = 1? (b msjmc and mgh pharmacies are medium risk compounding facilities. as such, we can assign beyond use dates of refrigerated compounded sterile products of no more than: - 4. Define g(x) = 2x3 + 1 a) On what intervals is g(x) concave up? On what intervals is g(2) concave down? b) What are the inflection points of g(x)? Which of the following correctly describes the complementary base pairing of adenine in both DNA and RNA?1) Adenine pairs with cytosine in DNA and guanine in RNA2) Adenine pairs with thymine in both DNA and RNA3) Adenine pairs with guanine in DNA and cytosine in RNA4) Adenine pairs with uracil in DNA and thymine in RNA5) Adenine pairs with thymine in DNA and with uracil in RNA A jogger running around a rectangular park takes a shortcut back to his car by running 53 meters from one corner to the opposite corner. If the park is 45 meters long, what is the width? A rectangular box with a square base and open top is the hold 1000 in. We wish to use the least amount of material to construct this box in the given shape. What are the dimensions of the box that uses the least material. the heat of vaporization of water is 40.66 kj/mol. how much heat is absorbed when 1.62 g1.62 g of water boils at atmospheric pressure? When mapping the process to acquire a paying customer, you should note whether payment will come from the customer's yearly operating budget or from the customer's long-term capital budget.a. true b. false A ladder is leaning against the top of an 8.9 meter wall. If the bottom of the ladder is 4.7 meters from the bottom of the wall, then find the angle between the ladder and the wall. Write the angle in Let f(x)=x^35x. Calculate the difference quotient f(3+h)f(3)/h forh=.1h=.01h=.01h=.1The slope of the tangent line to the graph of f(x) at x=3 is m=lim h0 f(3+h)f(3)h=The equation of the tangent line to the curve at the point (3, 12 ) is y= On January 1, Year 1, Your Ride Incorporated paid $30,000 cash to purchase a taxi cab. The taxi had a four-year useful life and a $3,700 salvage value. Required a. Determine the amount of depreciation expense that would appear on the Year 1 and Year 2 income statements. b. Determine the amount of accumulated depreciation that would appear on the Year 1 and Year 2 balance sheets. Year 1 Year 2 a Depreciation expense b. Accumulated depreciation S 6,576 $ 13,150 16.850 S 23,425 $ On January 1, Year 1, Your Ride Incorporated paid $30,000 cash to purchase a taxi cab. The taxi had a four-year useful life and a $3,700 salvage value. Required a. Determine the amount of depreciation expense that would appear on the Year 1 and Year 2 income statements. b. Determine the amount of accumulated depreciation that would appear on the Year 1 and Year 2 balance sheets. Year 1 Year 2 a Depreciation expense b. Accumulated depreciation S 6,576 $ 13,150 16.850 S 23,425 $ Which of the strands of DNA could act as a primer for the DNA sequence shown below? 5 ' CCCTGGGCTCTGTAAATGTTTCTAAGTG -3' 3' GGGACCCGAGACATTTACAAAGATTCAC -5' A: 3'-ACTGTTAGA-5' B: 3' -AAATTTGGC-5' C: 3' -ATGCTTTGA-5' D: 5' -GGGACCCGA-3' E: 5' CCCTGGGCT-3' which common aspects of elizabethan drama adhered to neoclassical rules? tell us about a time when you were resistant to change in your current workplace or former workplace. describe the scenario, why were you resistant, and explain the outcome. calcuate the enthalpy change upon converting 2.5g of water at -35.0 c to steam at 140.0 c under a constant pressure of 1 atm. An isolation transformer has the same input and output voltages. a. True b. False