Review this scenario. Rainbow trout are a freshwater fish native to streams and lakes along the western coast of North America. While studying streams in the eastern United States, an ecologist noticed that rainbow trout were abundant in the ecosystem, but other native species of fish were almost entirely missing. She also observed lower populations of macroinvertebrates. The ecologist wondered why there were so few native fish species and macroinvertebrates. By reading ecological reports of the area, the scientist learned that rainbow trout had been introduced to the streams for sport fishers to catch. Initially, 100 fish had been introduced, but the ecologist conducted a field survey and estimated that over 1,000 rainbow trout now lived in the streams. She also read from other studies that rainbow trout feed primarily on macroinvertebrates. Which question most closely relates to the ecologist's observations and the collected scientific data on river ecosystems? Do the native fish species have a disease? Are rainbow trout displacing native species by outcompeting them for food? Did pollution kill off the native fish species? Why are there so many rainbow trout in the streams?

Answers

Answer 1

The question that best relates to the ecologist's observations and the scientific data collected on river ecosystems is:

Is rainbow trout crowding out native species by competing with them for food?

The previous question that the ecologist very possibly must ask is due to the overabundance of rainbow trout and the very low number of native species.

In order for rainbow trout to adapt and reproduce quickly, it has had to feed on macroinvertebrate species, affecting the native fauna of this ecosystem and causing the displacement of other native species and even death due to lack of food.

You can find more information in this link:

https://brainly.com/question/9718639


Related Questions

a recipe calls for 1 cup of sugar and 1/2 cup of flour.Zoe uses 1 cup of salt and 1/2 cup of flour.
which kind of mutation is best modeled by zoes version of the recipe​

Answers

Answer:

Substitution

Explanation:

Given the information in the question substitution seems like the most appropriate answer. Zoe used 1 cup of slat rather than 1 cup of sugar, she substituted sugar for salt.

Insertion is wrong because Zoe did not add another ingredient, there is still only 2 ingredients.

Transition is wrong because, given the information, because the state(liquid or solid) of the ingredients has not changed. Zoe is still use dry ingredients per say.

And beneficial also seems to be wrong because we don't know if using salt instead was beneficial to the recipe or to Zoe.

Explanation:

Answer: Subsitution

Explanation: i took the quiz

There are three species of birds on an island. Bird A has a heavy bill for eating seeds.
Bird B has a pointed bill for eating insects. Bird C has a sharp bill for eating both insects
and seeds. If all insects on the island suddenly disappeared, which bird or birds would
be the LEAST affected?



Please help

Answers

Answer:

A and C would least be affected

Explanation:

because a doesn't live off of insects and see if insects do disappear it still has seed stuff all back on

Bird A will be least affected if all insects on the island suddenly disappeared because Bird A does not depend on the insects.

What is the survival of the fittest?

This theory suggests that the fittest organisms survive in the environment and reproduce.

The fittest organisms have most of the required traits to survive. Bird A eats the seeds, Bird -B eats the insects, and bird C eats both seeds and insects,

Therefore, Bird A will be least affected if all insects on the island suddenly disappeared because Bird A does not depend on the insects.

Learn more about survival of the fittest:

https://brainly.com/question/1226176

GVC – Understand how humans depend on and affect natural resources.
Learning Targets:
ESS4.1 – Construct an explanation for how the availability of natural resources, the occurrence of natural hazards, and changes in climate affect human activity.
ESS4.2 – Use computational thinking to explain the relationships between the sustainability of natural resources and biodiversity within a system.
ESS4.3 – Design solutions for developing, managing, and utilizing energy and mineral resources based on cost benefit rations on large and small scale
ESS4.4 – Design solutions for a major global or local environmental problem based on one of Earth’s systems.

Answers

Answer:

Hope It Help

Explanation:

That's all I know

A hypothetical phylogeny for marsupial relatedness is shown here. Macropodidae is the marsupial family. Which of these statements is supported by the phylogenetic tree shown here? Select ALL that apply.
A) M. bicolor and M. parma are in the same subspecies category. Eliminate
B) M. agilis and M. eugenii share the most recent common ancestor.
C) T. thetis and P. xanthpus share the most characteristics in common.
D) T. thetis and P. xanthpus share the greatest number of taxa levels than other species.
E) M. agilis and M. eugenii share the greatest number of taxa levels than other species.

Answers

Answer: B and E

Explanation: USATESTPREP

Select the correct answer.
Which activity does NOT contribute to global warming?
OA Driving cars
B. Releasing gases
C. Walking
OD Burning fuel

Answers

Answer:

walking

Explanation:

C. Walking doesn’t cause any harm to the environment or cause any sort of environmental change due to global warming issues. Walking is safe opposed to using fossil fuels.

symptoms of trisomy 13 ​

Answers

Answer:

Individuals with trisomy 13 often have heart defects, brain or spinal cord abnormalities, very small or poorly developed eyes (microphthalmia), extra fingers or toes, an opening in the lip (a cleft lip ) with or without an opening in the roof of the mouth (a cleft palate ), and weak muscle tone (hypotonia)

Explanation:

The salamander is an amphibian, so it has a as it grows and develops. The adult form is different from the larva because the adult .

Answers

Answer: The options are not given, here are the options from another website.

A. metamorphis

B. pupae stage

C)simple life cycle

Question 2

A)breathes through lungs

B. forms a pupa

C. lives completely underwater

The correct answers are A A.

Explanation:

Salamander go through process of metamorphosis that reproductive changes. They have a larvae stage that breathe through gills because the larvae are inform of a fish and gave gills for respiration while the adults breaths through lungs. The larvae stage develops 30 days after hatching and can possibly change into an adult like 60 after hatching.

Answer:

metamorphosis

Breathes through its lungs

I hope this helps


Students are growing plants in pots on the windowsill of
their classroom. After spring break, a student notices
that one of the potted plants furthest from the
windowsill has changed shape, as shown below....Which
statement best explains why this plant grew at a
different angle? *

A) A plant growth hormone accumulates in the shaded side
of the stems, causing the lower leaves to fall off.

B) A plant growth hormone accumulates in the shaded side of the stems, stimulating those sides to grow faster and
bend toward the light.

C) A plant hormone accumulates in the unshaded side of
plant cells, causing the plants to grow. much faster

D)A plant hormone accumulates in the shaded side of plant
cells, stimulating the plants to produce more flowers.

Answers

Answer:

ANSWER : B I think i am not sure i hope it helps

Rylee saw a cell under a microscope and drew what she saw. This cell is classified as —

Answers

Answer:

Well I need more information to answer that question.

Explanation:

Explanation:

can I have a picture of the question please

Which of the following best describes the material that makes up the Earth's asthenosphere
The Layers of The Earth
A. Liquid magma
B. A rigid solid
C. A soft solid that is able to flow (convection currents)


PLEASE HELP

Answers

Hi you have to be in here in a you know what you do it for you to do that you can help you get your money I will send it

where does mold come from​

Answers

Answer:

Mold will grow in places with a lot of moisture, such as around leaks in roofs, windows, or pipes, or where there has been flooding. Mold grows well on paper products, cardboard, ceiling tiles, and wood products. Mold can also grow in dust, paints, wallpaper, insulation, drywall, carpet, fabric, and upholstery

Answer:

Mold comes from wetness.

Explanation:

When there is enough moisture and just enough light, mold will grow. In fact, mold is classified as a type of plant: fungi.

Please mark me as brainliest

If you know that small sharks and large sharks are the top two consumers in a food chain, which of the
following pairs would start your food chain?
O dinoflagellates, ocean sunfish
O copepods, ocean sunfish
energy from sun, dinoflagellates
O energy from sun, copepods

Answers

Answer:

Dinoflagellates

Explanation:

Dinoflagellates are algae

Compare primary succession and climax community. Be sure to identify how long-term survival of species is dependent on resources that may be limited.

Answers

Answer:

Primary succession is the colonization of species of organisms on life-less barren lands after a volcanic eruption, newly formed land, or sand dunes. Lichens and mosses are the known primary succession community of organisms that helps in developing conditions for secondary succession by breaking rocks and providing soil.

After a fair amount of time, there are new species of organisms that grow and colonize in the land and these are, and ultimately the community becomes fairly stable. A climax community is a more stable, mature community that undergoes little or no change which can live for hundreds of years on the land.

The long-term survival of species is dependent on various kind of resources that may be limited, this can be explained by the lichens and mosses that have enough amount of nutrition and resources during primary succession but as new organism comes with complex structure and competes with these lichens and mosses their number decline due to limited amount of resources.

Name one basic characteristic for classifying organisms.
If you are sure then only give the answer otherwise you can leave.​

Answers

Answer:

The more basic characteristic for classifying organisms is the kind of cells they are made of because different organisms may share same habitat but may have entirely different form and structure.

I hope it's helpful for you...

High blood pressure is a common and dangerous condition affecting about 75 million people in the United States. It is known as the "silent killer" because many people don't know they have it. This contributes to the disease being the second leading cause of death of Americans.

Which of the following lifestyles would increase the risk of high blood pressure?



Group of answer choices:

Living a calm sedentary lifestyle on an island that is hit by an occasional hurricane.

Losing weight after childbirth.

Attending water aerobics class 4 times a year.

Eating meals that include fruits, vegetables and grains.

Answers

Answer:

losing weight after childbirth

Explanation:

This contributes to the disease being the second leading cause of death of Americans. Losing weight after childbirth.

What can high blood pressure cause?

Factors that can lead to high blood pressure have: A diet high in salt, fat, and/or cholesterol.

Chronic diseases such as kidney and hormone problems, diabetes, and high cholesterol.

Family background, quite if your parents or other close relatives have high blood pressure.

Thus, option "A" is correct,  Losing weight after childbirth.

To learn more about childbirth click here:

https://brainly.com/question/16013075

#SPJ2

HELLHELEPEGELLHELLPPPPPPPPP help please

If an acorn falls off a tree, is it living or non-living??

Answers

Answer: living

Acorns are still alive even off the tree and eventually grow into plants in the right conditions.

Answer:

Acorns are alive. Acorns live and breathe. Since they have no teeth and claws, acorns defend themselves with have chemicals called tannins. Because acorns decompose slowly, some gardeners compost them separately from other materials that break down more rapidly. Others grind them before composting them, as this speeds up decomposition.

therefore they are still living

Explanation:

brainliest?


5. Explain the process through which natural selection can lead to a new species of organism.

Answers

Answer:

Through this process of natural selection, favorable traits are transmitted through generations. Natural selection can lead to specistion, where one species gives rise to a new and distincly different species.

Which of the following best predicts and justifies how the proportion of the Tibetan population with big blood vessels living in the mountains will change over the next 1,000 years (assuming conditions remain stable)?

Question 2 options:

I predict that the proportion of individuals with big blood vessels living in the mountains will decrease because there is a variation in blood vessel size and those with the smaller blood vessels can store more red blood cells than larger vessels, so more oxygen can be moved to the body cells. Therefore, they have a better chance of surviving and passing this trait on to their offspring.


I predict that the proportion of individuals with big blood vessels living in the mountains will stay the same because there is a variation in blood vessel size and that variation will remain in a population. The is what is so cool about humans, we are all so unique.


I predict that the proportion of individuals with big blood vessels living in the mountains will increase because there is a variation in blood vessel size and those with the bigger blood vessels can deliver more oxygen to the body cells and therefore have a better chance of surviving and passing this trait on to their offspring.


I predict that over 1,000 years, the proportion of individuals with big blood vessels living in the mountains will not change because a change can’t happen to an individual, an individual can only increase the amount of red blood cells it makes, not its blood vessels.

Answers

Answer:

Over 1,000 years, the proportion of individuals with big blood vessels living in the mountains will not change because a change can’t happen to an individual, an individual can only increase the number of red blood cells it makes, not its blood vessels.

Explanation:

Evolution is the change in the characteristics of a species over several generations and relies on the process of natural selection

What is blood vessels?

The blood vessels are the components of the circulatory system that transport blood throughout the human body.

I predict that over 1,000 years, the proportion of individuals with big blood vessels living in the mountains will not change because a change can’t happen to an individual, an individual can only increase the amount of red blood cells it makes, not its blood vessels.

Hence, option D is correct.

Learn more about blood vessels here:

https://brainly.com/question/4601677

#SPJ2

Explain how a school bus uses all of these energy types.

-Mechanical
-Chemical
-Electrical
-Thermal

Answers

Answer:

Mechanical

94 percent of all school buses in America are powered by diesel engines because of their reliability, durability and safety. Almost half of these (46 percent) rely on the cleanest, near-zero emission diesel engine technology.

Chemical

school bus uses petroleum as chemical potential energy.

Electrical

An electric bus draws electricity from the power grid and stores it in a battery that can be recharged once the electricity has been used up. This basically mirrors the way our electronics work. We plug them in and let the battery charge and then use them wirelessly until it's time to charge again

Thermal

They heat the cold coolant from engine's block to 160° F in as little as one hour, then pump it back to the vehicle's engine and heat exchangers. The result: engine is preheated and the vehicle's heat exchangers distribute an abundance of heat to the vehicle's interior.

During fertilization, sperm cells will either contain an x or a y chromosome in addition to 22 other chromosomes, totaling______

Answers

The answer is A because

energy is stored during photosynthesis. true or false

Answers

True because plant needs them

what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAACCACAACT and TACCTGTTAAGCTACAAAATT?

Answers

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

LOOK AT PIC!!!!!!!!!!!!!

Answers

Answer: black

Explanation:

Yes

Answer:

wow it is blank

Explanation:

What does "reliability" mean in these sentences?

Answers

Answer:

The first one is correct

Answer: The first one, the quality of being able to be trusted.

Don't really know how to explain but being reliable is being trustworthy and responsible.

please help with this biology question!

Answers

Answer:

mito

Explanation:

Answer: mitochondria

Explanation: don't have mitochondria for energy production, so they must rely on their immediate environment to obtain usable energy

HELP AGAIN

askjcnoianlkscnoxicn

Answers

Answer:

a hope it helps make brainlliest ty

Explanation:

make free póínts again please

A group of students wants to study the structures of animals in the desert. One question they should ask is-
How long do the animals live?
Can you buy the animals in pet stores?
How do the animals satisfy their need for water?
How many offspring do the animals have?

Answers

Answer:

Jdjdjdj

Explanation:

Animals survive in deserts by living underground or resting in burrows during the heat of the day. Some creatures get the moisture they need from their food, so they don't need to drink much water, if any. Others live along the edges of deserts, where there are more plants and shelter.

Even though deserts don't get much rain, the desert is a habitat for some plants and animals. Each species has adapted to be able to live in a range of temperatures and without much water. ... Animals that live in deserts include lizards, geckos, toads, jackrabbits, camels, snakes, spiders and meerkats.

How can G and cloning be used in medical science

Answers

Answer:

for testing differnt cures on animals

Explanation:

Put the following in order describing the process of using geothermal energy to create energy.
= Heat is collected from the Earth
= Steam turns a turbine.
= Generators produce electricity.
= Heat is used to change water into steam.

Answers

Answer:

1. heat is collected from the earth

2. heat is used to change water into steam

3. steams turns a turbine

4. generators produce electricity

Explanation:

Which of the following is an example of cross contamination? *
1 point
cutting a tomato and lettuce on the same cutting board
cutting chicken and a tomato on the same cutting board
washing the cutting board with hot water and soap before cutting each ingredient

Answers

Cutting chicken and tomato on the same cutting board
Other Questions
which of the following describes passing by reference? Write one sentence in spanish to tell what class you don't like Please please help I dont understand this The graph of linear function k passes through the points (-3, 0) and (1, 8). Which statement must be true?A. The x-Intercept of the graph of k is 8.B. The slope of the graph of k is 2.C. The graph of k passes through (-1, -8).D. The zero of k is 3.Fr someone help me Please help me w this PLEASE HELP RN AQAPTHANKS! Observe the model below. Explain one strength(advantage) of the model and one limitation ( disadvantage) of the modelanswer ASAP what is the maximum receiving temperature for tcs in degrees fahrenheit Please answer all 4 questions:) Select the correct location on the map Which city did the romans destroy at the end of the third Punic war? .. Why did many Puritans support the Half-Way Covenant? Do you think Robespierre was justified (right) in clamping down on people's rights during this time? What is another way to say that Social media can blur the lines of whats real and whats not because it can cover the truth and control peoples opinions of the situation? EvaluateWrite your answer as a fraction in simplest form.HELP PLEASE A car is traveling at 40 mi/hour. What is the car's speed in feet per second? which president is the only one to serve two non-consecutive terms? Jane started jogging home from 5 miles away, at a rate of 2 mph. Which equation in slope-intercept form represents Jane's distance from home? What does Stevenson mean by I looked like a man at death's door Which data set has the same standard deviation as the data set {2,2,5,6,8}?A. {3,4,4,7,7}B.{5,6,5,6,5}C.{3,3,6,7,9}D.{4,4,5,5,5} Actividades de Desarrollo Actividad 1. En el siguiente ejercicio identificars los elementos de los trminos algebraicos (signo, coeficiente, literal y exponente) en los espacios correspondientes. Considera que, si no existe un signo explcitamente, lo debers indicar como positivo (+), de igual forma, de no ser visible un exponente, su valor ser de uno. a) -21x3w? Signo: - Coeficiente: 21 Literales: X, W Exponentes: 3.7 b)-755 Signo: Coeficiente: Literales: Exponentes: Literales: c) 8a2b5 Coeficiente: Exponentes: Signo: Literales: Exponentes: Coeficiente: Signo: Literales: Exponentes: Coeficiente:_ Signo: Literales: Exponentes: Coeficiente: Signo: d) m11 e) xyws ni ayb e) xyws e) xyws Literales: Exponentes: Coeficiente: Signo: Signo: Exponentes: Literales: 28 Coeficiente: ACADEMIA NACIONAL DE MATEMATICAS DGETI Steam Workshop Downloader