What is 256 square root??

Answers

Answer 1

Answer:

16

Step-by-step explanation:

[tex]\sqrt{256} \\=\sqrt{16 * 16} \\=16[/tex]

Answer 2

Answer: 16

Step-by-step explanation: √

256=16

at least that's the positive square root

−16

is also a square root of 256.

16²=(−16)2=256

By definition, the principal square root of a number is the positive square root. The term "the square root" is commonly used to refer to the principal (positive) root though there are usually two roots.


Related Questions

Solve x-2/y = z for y.

Answers

Answer:

y = 2/x - z

Step-by-step explanation:

Which is an advantage of a personal interview?

A. It is quick to complete.

B. The data is easily combined due to the closed questioning method

C. It is inexpensive to administer.

D. The closed questioning method limits the amount of information.​​

Answers

Answer:

i think B. the data is easily combined due to the closed questioning method.

Step-by-step explanation:

The advantage of a personal interview is that data is easily combined due to the closed questioning method

What is an interview?

An interview is a discussion or conversation between a potential employer and a candidate.

Given is an advantage of personal interview.

A personal interview involves a face to face interaction between a recruiter and a candidate. The closed questioning method involves the selection of answers from the given multiple options for example - questions whose answers include a selection from yes or no. This helps in the easy collection of data since the answer given represents the direct and to the point idea about how an individual thinks.

Therefore, the advantage of a personal interview is that data is easily combined due to the closed questioning method

To solve more questions on personal interview, visit the link below-

https://brainly.com/question/14449118

#SPJ2

(12p^2 + 15p + 3) - (2p^2 + 17p - 2)

Answers

Answer:

10p² - 2p + 5

Step-by-step explanation:

Step 1: Write expression

(12p² + 15p + 3) - (2p² + 17p - 2)

Step 2: Distribute negative

12p² + 15p + 3 - 2p² - 17p + 2

Step 3: Combine like terms

10p² - 2p + 5

preform the indicated operation.
4/11 ÷ 4/9​

Answers

Answer:

0/8

Step-by-step explanation: i tried my best

Answer:

9/11

Step-by-step explanation:

4/11 divided by 4/9=

4/11 x  9/4= 1/11x9=

9/11

Solve for f(2) and f(x+4)
f(x)= 3x^2-4x+7

Answers

Answer:

The answer for f(2) is 11. The answer for f(x+4) is f = 3x^2 - 4x + 7 / x + 4

Step-by-step explanation:

What are the dimensions of the cereal box?

The length is
in., the width is
in., and the height is
in.

Answers

Answer:

The length is 6 in., the width is 2 in., and the height is 16 in.

Answer:

length 6in.

width 2in.

height 16in.

Step-by-step explanation:

edge 2020

What is the answer of question 17 in lesson 2.1 translations

Answers

9514 1404 393

Answer:

y = 2x(1, 2)

Step-by-step explanation:

The line representing Murphy street goes through point (0, 3) and has a slope of 2/1 = 2. Its equation is then ...

  y = mx + b

  y = 2x +3

The translation vector transforms this equation* by adding -1 to y, and replacing x with x-1.

  y = (2(x-1)) +3) -1

  y = 2x -2 +3 -1 . . . . eliminate parentheses

  y = 2x . . . . . . . . . . . the equation for Nolan street

__

Of course, adding (1, -1) to the point (0, 3) moves it to ...

  (1, -1) +(0, 3) = (0+1, -1+3) = (1, 2)

The image of (0, 3) is (1, 2).

_____

* f(x) is translated by (a, b) this way: g(x) = f(x-a) +b. Here, f(x) = 2x+3 is translated to f(x-1)+(-1) = (2(x-1) +3) -1.

How can you tell that the inequality 3t+1> 3t + 2
has no solution just by looking at the terms in the equality?

Answers

Answer:

see below

Step-by-step explanation:

3t+1> 3t + 2

Subtract 3t from each side

1>2

This is never true so there is no solution

Since the variable terms are the same, we only have to look at the constants

What is the product of 7/8×1/2

Answers

[tex] \frac{7}{8} \times \frac{1}{2} [/tex]

[tex] = \frac{7 \times 4}{8} [/tex]

[tex] = \frac{28}{8} [/tex]

[tex] = \frac{ \cancel{28}}{ \cancel{8}} [/tex]

[tex] = \frac{14}{4} [/tex]

[tex] = \frac{ \cancel{14}}{ \cancel{4}} = \frac{7}{2} [/tex]

The required answer is 7/2

Answer:

7/8 ×1/2=7/16 is your answer

Triangle ABC has the coordinates A(-3, -2), B(2, 4) and C(2,-2). What is the area of triangle ABC?
square units

Answers

Answer:   The area is 15 square units

Step-by-step explanation:  It is helpful to sketch the coordinates on a graph to get an idea of what the triangle looks like so you can see which side will be the base, and where to get the height. You will see that AB is the hypotenuse, it is a right triangle, so AC can be the base and BC is the height.

Use the differences in x-values of points C & A to get the length of the base:   2-(-3) is 5

Use the differences in y-values of points B & C to get the height:

4-(-2) = 6

Area = bh/2

A = 5×6/2 = 30/2

A = 15 square unts

how can i get 6 from four 6s . 6?6?6?= 6 we have to use -,+, division or multiplication

Answers

Answer:

ur wegfew

Step-by-step explanation:

Answer:

6?6?6?6?=6 can be 6+(-6)+*6+6which is equal to 6

I MADE ONE OF THE SIXS NEGATIVE SO, IT CAME AS 6+ NEGATIVE 6=0 AND THEN MULTIPLIED ONE SIX SO, 0*6=0 AND THEN FOR THE LAST SIX I MADE IT ADDITION SO, 0+6=6

AND THUS, FINAL ANSWER BECAME 6 ITSELF

The temperature in the late afternoon was -7.5° it dropped 5° by early evening and then dropped another 85° by midnight what was the temperature at midnight

Answers

Step-by-step explanation:

i think you missed a decimal place for 8.5°

when temperatures drop it means minus

so

-7.5-5-8.5= -21°

I need help please ​

Answers

I am pretty sure its B (minimum at -1, -4) because that would be were the first point would be at. The Graphing of this equation would be a "upside down u" shape.

Your bank account hos a bolance of -$17. You deposit $70. What is your new balance? Show work:​

Answers

Answer:

53

Step-by-step explanation:

70-17= 53

Answer:

$53

Step-by-step explanation:

I'm not sure how to demonstrate it here, but you can use a number line to show your work.

Draw the starting point as -17 then jump 70 times to the right.

DUE TODAY WORTH ALOT OF POINTS!!!! PLEASE HELP!!!

Answers

I’m sorry I can’t see the questions

In parallelogram ABCD, the measure of angle A is 99 degrees. Explain why the
measure of adjacent angle B must be 81 degrees.

Answers

Answer:

The measure of angle B must be 81° because angles A and B are interior supplementary angles

Step-by-step explanation:

Let us revise the properties of a parallelogram

In any parallelogram:

Every two opposite sides are parallelEvery two opposite sides are equal in lengthEvery two opposite angles are equal in measureEvery to adjacent angles are interior supplementary angles

Let us solve our question

In parallelogram ABCD

∵ AD and BC are opposite sides

AD // BC

∵ ∠A and ∠B are adjacent angles

→ That means ∠A and ∠B are interior supplementary angles

∠A and ∠B are supplementary angles

∵ The sum of the measures of the supplementary angles is 180°

m∠A + m∠B = 180°

∵ m∠A = 99°

∴ 99° + m∠B = 180°

→ Subtract 99° from both sides

∴ 99° - 99° + m∠B = 180° - 99°

m∠B = 81°

The measure of angle B must be 81° because angles A and B are interior supplementary angles

Solve for z.

Pls pls pls

Answers

Step-by-step explanation:

please follow me I follow you back

Answer:

The answer is 52 degrees

Step-by-step explanation:

This is because the angle below is a right angle. So rightangles equal 90 degress and we were given 38 degress in that quadrant so all we had to do was subtract 38 from 90 and that is your answer. I hope this helps!

Solve the notable products (1/7x-1/7)

Answers

The Answer is 1/7(x-1)

What is the constant of the expression x2+15x+24y+10?

Answers

Answer:

=x2+39x+10

Step-by-step explanation:

Combine Like Terms:

=x2+15x+24x+10

=(x2)+(15x+24x)+(10)

=x2+39x+10

The constant of the given expression is 10.

The given expression is x²+15x+24y+10.

What is an expression?

An expression is a combination of terms that are combined by using mathematical operations such as subtraction, addition, multiplication, and division.

A constant is a value or number that never changes in expression; it's constantly the same.

The constant of the expression x²+15x+24y+10 is 10.

Therefore, the constant of the given expression is 10.

To learn more about an expression visit;

https://brainly.com/question/28170201.

#SPJ2

What is 75% of 30 meter

Answers

I think the answer is

22.5 meter

it is because 7.5 meter ×4=30m

so 7.5+7.5+7.5=22.5 m

2, 1, 2 unlike these people i actually did it. edge

Answers

Answer:

waitttt what do u mean?

Hold up what do u mean?

What is a+4+3+h+3+4+333+f=f+3+333h
solve and i will make you Brianlyest

Answers

Answer:

a + h + f + 344 = 2f +3 + 333h

Step-by-step explanation:

(Even though that equation has no sense that is what you would get.)

Answer:

Step-by-step explanation:

h =1                  86

---------- Sa + ------------

332 .                83

Simplify by combining like terms 2x + 5 + x

Answers

Answer:

3x+5

Step-by-step explanation:

combine like terms add the variables together, then its simplified

The expression in simplest form is represented as 3x+5

Which set of numbers could represent the lengths of the sides of a right triangle?

Answers

Answer:

number 4: 8, 15,17

Step-by-step explanation:

This is all just the theorem that a^2+b^2=c^2 so I tried that for all of them and number 4 is the only one that ends as a whole number. Sorry, that wasn't the best explanation but I hope you understood. Just try the theorem on each one like 4(2^2)+9(3^2) doesn't equal 16(4^2)

7. Kayla has set aside $105 to spend on books and CDs. Each book b cost $5 and each CD c costs $12. Which inequality could be used to determine how many books and CDs Kayla can buy?

Answers

5b+12c=105    She can buy 21 Books or 8 CDs and 1 book or a variation of both.

This is due today and I need some help please!!

Answers

Answer:

Option D is the answer : 8.8 * 10^-5

PLZ HELP ASAP.....Your dad is researching landscaping companies to come put new mulch out for the year. The first company charges $100 just to come out, plus $10 per bag of mulch, m, needed. The second company doesn’t charge to come out but charges $30 per bag of mulch. After how many bags of mulch will the total cost of each company be the same?

Answers

Answer: After 5 bags of mulch, the cost for both companies will be the same.

Step-by-step explanation:

The cost for Company can be represented by the equation: y= 10m+100

The cost for Company B can be represented by the equation: y= 30m

To find the amount of mulch, their cost needs to be the same, I will solve for m

10m+100=30m

-10m 10m

100=20m

Divide both side by 20

100/20=20m/20

5=m or m=5

So after 5 bags of mulch, the total cost for both companies is the same.

Help with all these plz!

Answers

Answer:

9    10     10   17   3

Step-by-step explanation:

Find the slope from the graph below.

Answers

Answer:

X=-2 (The slope is - 2/1)

Three farmers buy a total of 2,249 acres of land at an auction, Farmer Mel buys land that is 3 times as many acres as Farmer Cassius's land. Farmer Cassius buys land that is 3 times as many acres as Farmer Anne's land. How many acres of land does each farmer buy?​

Answers

Answer:

Farmer Anne's land = 173 acres

Farmer Cassius = 519 acres

Farmer Mel = 1,557 acres

Step-by-step explanation:

Total acre = 2,249

Let

Farmer Anne's land = x

Farmer Cassius = 3x

Farmer Mel = 3(3x) = 9x

x + 3x + 9x = 2,249

13x = 2,249

x = 173

Farmer Anne's land = x = 173 acres

Farmer Cassius = 3x

= 3(173)

= 519 acres

Farmer Mel = 3(3x) = 9x

= 9(173)

= 1,557 acres

Therefore,

Farmer Anne's land = 173 acres

Farmer Cassius = 519 acres

Farmer Mel = 1,557 acres

Other Questions
Carbon decays every 5700 years. If you found a rock containing Carbon that has gone through 2.5 half lives, how old is that rock? Love after Love By Derek Walcott What are machines fueled by?1. Energy 2. Electricity only3. gasoline only4. Sun You measure containers for international shipments. The height of the standard container is 6 feet and 7 inches. What is the height in meters? TIME REMAINING52:45The robotic rover Curiosity has instruments that detect radiation both inside the spacecraft and in the Mars environment. What is most likely the purpose of this radiation detection?to determine whether human exploration of Mars is possibleto develop better X-ray technologyto find evidence of once-living Martian microorganismsto investigate evidence of hydrogen and water (1/3)^2=? I need help with math I'm failing, because of my teacher By finding out who Figaro's parents are how does this inconvenience the Count? Starting from rest, a car travels 18 meters as it accelerates uniformly for 3.0 seconds. What is the magnitude of the car's acceleration? A. 6.0 m/s2 B. 2.0 m/s2 C. 3.0 m/s2 D. 4.0 m/s2 78There are 32 desks in a room.If x represents the number of rows of desks, which expression would equal the number of desks in each row?0 32 + x32 - xO 320 3/x Rafael can type 24 words in 6 minutes. What is his rate in words per minute what happen when two light waves traveling from oppsite direactions meet? if a doctor states that a patient has a bone break in the left anterior portion of their body, lateral to midline in their thoracic cavity, what can you assume im broken? In the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?A. TATTCATTCATTATGATTTATTCGB. TATTCATTGTTATGACTTTATTCGC. TATTCATTGTTATGATTTATTGGCGD. TATTCATTGTTATGATATTCGE. TGCATTCATTGTTATGATTTATTCG Which changes resulted from industrialization in the United States in the late 19th and early 20th centuries?A) increased number of people living in urban areasB) less crowded citiesC) more efficient farm production as machines replaced human laborD) decreased immigration from other countriesE) shift from a predominance of agricultural workers to a predominance of factory workers PLEASE HELP ME ANSWER AS MUCH AS YOU CAN I ONLY HAVE 3 POINTS LEFT AND IM TIMED. PLEASE TELL ME THE NUMBER AND LETTER. THANK YOU!!!!!!!!!!!1. Read the excerpt from a students report.I was honored to be a part of an online group of students from the United States, Africa, and China seeking solutions to water shortages. While we all had great enthusiasm about changing the world, the project quickly dissolved because no one was willing to listen to differing viewpoints.Which line could be added to show the difference a digital leader can make? A. We agreed as a group to spend some time studying each others country and meet again at a later date. B. We saved the project by allowing each group to share their thoughts and then chose the best solutions.C. We decided to disband and seek solutions with students from other countries who shared our viewpoints. D. We thought it would be best to stop meeting until our cultural differences can be addressed._______________________________________________________2. Electronic medical charts make it easier for doctors to A. share information on patients with other doctors. B. share information on patients with the government.C. communicate with patients about medical issues.D. track infectious diseases through a database.______________________________________________________3. Which is the best example of collaboration in a digital environment?A. Students meet in-person at a local library.B. Students work together on a project from a distance.C. Students work independently on a project from a distance. D. Students meet in a classroom to research a project._______________________________________________________4. In addition to talking to other doctors remotely, telehealth technologyA. allows patients and doctors to talk online.B. gives doctors the ability to keep people healthier.C. eliminates the need for doctors to see patients. D. allows patients to self-diagnose using the Internet. Exchanging goods or services of equal value is called (blank)(blank) replaces the need for bartering.Money allows us to exchange (blank) for goods and services. 275,000 plus 5.4 times 10 to the 5th power Whats a religion ??? Javier has a basket of oranges and apples. The number of oranges is 2 more than twice the number of apples in the basket. The difference of half the number of oranges and half the number of apples is 4.An equation created to find the number of apples Javier has in the basket will have What are all the correct equations